Steroid burun spreyi

Total RNA from tissues was extracted and reverse transcribed to cDNA. Quantitative RT-PCR was performed using StepOnePlus system (ABI, Foster City, USA) and SYBR Premix Ex Taq kit (TaKaRa Biotechnology, Dalian, China) as described previously [ 23 ]. The PCR amplification consisted of one cycle at 95 °C for 2 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 10 s, and then extension at 72 °C for 15 s. At the end of each PCR run, a melting curve analysis was used to confirm production specificity. Glyceraldehyde phosphate dehydrogenase (GAPDH) gene expression was used for normalization. Relative gene expression was calculated using comparative cycle threshold (2 −ΔΔ Ct) method. No PCR product was amplified in the negative control. The following primers for PCR were adopted: EP1, forward 5'-GGTGTCGTGCATCTGCTGGA-3' and reverse 5'- CAAGAGGCGAAGCAGTTGGC-3' (187 bp); EP2, forward 5'-AGACGGACCAC CTCATTCTC-3' and reverse 5'-GATGGCAAAGACCCAAGG-3' (176 bp); EP3, forward 5'-CCCGCCTCAACCACTCCTA-3' and reverse 5'-CACCGATCCGCAAT CCTC-3' (107 bp); EP4, forward 5'-AACTTGATG GCTGCGAAGACCTAC-3' and reverse 5'-TTCTAATATCTGGGCCTCTGCTGTG-3' (128 bp); GAPDH, forward 5'- AGAAGGCTGGGGCTCATTTG -3' and reverse 5'-AGGGGCCATCCACAGTCT TC -3' (258 bp).

Steroid burun spreyi

steroid burun spreyi

Media:

steroid burun spreyisteroid burun spreyisteroid burun spreyi

http://buy-steroids.org